Part:BBa_K123001:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQ96a17c3008bbeea5-partinfo-00000000-QINU UNIQ96a17c3008bbeea5-partinfo-00000001-QINU

•••• Bielefeld-Germany 2011

Improved BioBrick for bisphenol A degradation with E. coli We improved the BPA degradation in E. coli by creating the BisdAB fusion protein BBa_K525515. See the comparison between polycistronic expression of BisdA and BisdB and this fusion protein below. Further information about bisphenol A degradation: Bisphenol A degradation overview page, [http://2011.igem.org/Team:Bielefeld-Germany/Project/Background/BPA Bielefeld-Germany 2011 Background] Part needed for characterizing the improved BPA degrading BioBrick: BBa_K525512, BBa_K525515, BBa_K525517 Wrong sequence in the parts.igem! Sequence is not entered into the parts.igem correctly. This BioBrick was probably synthesized in the Freiburg assembly standard 25 because it has the accordant restriction sites and it was codon optimized for Escherichia coli but the original sequence from Sphingomonas bisphenolicum was sent to the registry because amino acid sequence of the real sequence and the sequence that was entered is identical (translated in silico). Fig. 1: Alignment of the DNA sequence of BBa_K123001 entered into the parts.igem (K123001 registry) with our sequencing results (K123001 real) for this BioBrick (made with Clonemanager). Fig. 2: Alignment of the aminoacid sequence (translated in silico) of BBa_K123001 entered into the parts.igem (K123001 registry) with our sequencing results (K123001 real) for this BioBrick (made with Clonemanager). Bisphenol A degradation with BioBricks BBa_K123000 and BBa_K123001 The bisphenol A degradation with the BioBricks BBa_K123000 and BBa_K123001 works in E. coli KRX in general. Because Sasaki et al. (2008) reported problems with protein folding in E. coli which seem to avoid a complete BPA degradation, we did not use the strong T7 promoter for expressing these BioBricks but a medium strong constitutive promoter (BBa_J23110). With this promoter upstream of a polycistronic bisdAB gene we were able to completely degrade 120 mg L-1 BPA in about 30 - 33 h. By fusing BBa_K123000 and BBa_K123001 together we could improve the BPA degradation of E. coli even further, so 120 mg L-1 BPA can be degraded in 21 - 24 h. This data is shown in the following figure: Error creating thumbnail: Invalid thumbnail parameters Figure 3: BPA degradation by E. coli KRX carrying genes for BisdA and BisdB (only bisdA (black), polycistronic bisdAB (red) and fusion protein between BisdA and BisdB (green)) behind the medium strong constitutive promoter BBa_J23110 with RBS BBa_B0034. Cultivations were carried out at 30 °C in LB + Amp + BPA medium for 24 h and 36 h, respectively, with automatic sampling every three hours in 300 mL shaking flasks without baffles with silicon plugs. At least three biological replicates were analysed (three for bisdA alone, seven for bisdAB polycistronic and five for the fusion protein). We also carried out these cultivations at different temperatures and BPA concentrations, but the chosen conditions (30 °C and 120 mg L-1 BPA) seem to be the best. Higher BPA concentrations have an effect on the growth of E. coli and higher temperature leeds to a worse BPA degradation (probably due to misfolding of the enzymes). These data on the effect of the temperature on the BPA degradation is shown in fig. 4. Error creating thumbnail: Invalid thumbnail parameters Figure 4: BPA degradation by E. coli KRX carrying genes for BisdA and BisdB (polycistronic bisdAB (black) and fusion protein between BisdA and BisdB (striped)) behind the medium strong constitutive promoter BBa_J23110 with RBS BBa_B0034. Cultivations were carried out at different temperatures in LB + Amp + BPA medium (starting concentration 120 mg L-1 BPA) for 24 h in 300 mL shaking flasks without baffles with silicon plugs. Samples were taken at the end of the cultivation. Three biological replicates were analysed. As shown by [http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2672.2008.03843.x/full Sasaki et al. (2008)], BisdB expressed in E. coli leeds to hardly no BPA degradation. In our experiments we could not detect the BPA degradation products 1,2-Bis(4-hydroxyphenyl)-2-propanol and 2,2-Bis(4-hydroxyphenyl)-1-propanol in cultivations with E. coli expressing BBa_K123000 or BBa_K123001 alone (neither via UV- nor MS-detection). The BPA degradation products 1,2-Bis(4-hydroxyphenyl)-2-propanol and 2,2-Bis(4-hydroxyphenyl)-1-propanol were identified via MS-MS (m/z: 243 / 225 / 211 / 135) and only occured in cultivations with E. coli expressing BisdA and BisdB together. So in the fusion protein, both domains (BisdA and BisdB) are active and correctly folded because otherwise there would be no BPA degradation product. The higher specific BPA degradation rate in E. coli expressing BisdA | BisdB fusion protein could be explained either by improved folding properties of the fusion protein or by the closer distance of BisdA and BisdB in the fusion protein leeding to a more efficient reaction. Methods Cultivations Chassis: Promega's [http://www.promega.com/products/cloning-and-dna-markers/cloning-tools-and-competent-cells/bacterial-strains-and-competent-cells/single-step-_krx_-competent-cells/ E. coli KRX] Medium: LB medium supplemented with 100 mg L-1 Ampicillin and 120 mg L-1 bisphenol A (Sigma, 97 %) BPA is thermally stable -> you can autoclave it together with the medium 100 mL culture in 300 mL shaking flask without baffles (Schott) with silicon plugs Cultivation temperature: 24 °C, 30 °C or 37 °C, tempered with Infors AG AQUATRON at 120 rpm for characterizations: automatic sampling every three hours with Gilson fraction controller F2XX cooled (< 4 °C) with Julabo F10 water bath the characterization experiment setup is shown on the picture on the right Extraction with ethylacetate mix 100 µL culture supernatant with 100 µL internal standard bisphenol F(Alfa Aesar, 98 %) , 100 µg L-1) add 200 µL ethylacetate (VWR, HPLC grade) for extraction vortex (30 s) centrifuge for phase separation (5 min, 5000 g) take a bit from upper phase and put it in a clean eppi SpeedVac at 40 °C to remove ethlyacetate solve remaining BPA in water (HPLC grade), vortex (30 s) solubility of BPA in water only 300 mg L-1 for LC-MS analysis of BPA, 300 mg BPA L-1 is rather too much if you want to detect or expect higher concentrations of BPA, solve it in an acetonitrile-water-mix HPLC method C18 reverse phase column Isocratic method: 45 % Acetonitrile Flow = 0.6 mL min-1 UV-detection at 227 nm Internal standard: 100 mg L-1 bisphenol F (BPF) Column: Eurospher II 100-5 C18p by [http://www.knauer.net/ Knauer] Dimensions: 150 x 4.6 mm with precolumn Particle size: 5 µm Pore size: 100 Å Material: silica gel Software: Clarity (Version 3.0.5.505) by [http://www.dataapex.com/ Data Apex] Autosampler: Midas by [http://www.spark.nl/ Spark Holland] Tray cooling: 10 °C Pump: L-6200A Intelligent Pump by [http://www.hitachi.com/ Hitachi] UV-Detector: Series 1050 by [http://www.hp.com/ Hewlett Packard] LC-ESI-qTOF-MS(-MS) HPLC method Column: C18 reverse phase column (Knauer [http://beta.knauer.net/products/column-detail-view/productdetail/vertex_plus_column_50_x_2_mm_blueorchid_175_18_c18-1.html Blue Orchid]) dimension: 50 x 2 mm Pore size: 175 Å Particle size: 1.8 µm Flow: 0.4 mL min-1 Column temperature: 30 °C Gradient: 0 - 1.05 min: 45 % acetonitrile 2.55 min: 95 % acetonitrile 6.00 min: 95 % acetonitrile 6.15 min: 45 % acetonitrile 12.00 min: 45 % acetonitrile VWR Hitachi LaChrom ULTRA HPLC equipment Software: HyStar 3.2, HyStarPP, mircrOTOF Control Ionization method Using Bruker Daltonics micrOTOFQ ESI in negative mode Mass range: 50 - 1500 m/z End plate offset: - 500 V, 107 nA Capillary: 2500 V, 4 nA Nebulizer: 3 bar Dry gas: 8 L min-1 Quadrupole Ion energy: 5 eV Low mass: 100 m/z Collision energy: 10 eV Collision RF: 150 Vpp Transfer time: 70 µs Pre puls storage: 7 µs MS-MS Isolated mass: 243.1 +/- 0.1 Collision energy: 30 eV

•••• Caltech iGEM

The sequence given does not match up with the sequence of the part; the amino acids are the same, but the codons are different. We sequenced this part ourselves and found the following sequence: ATGGCCGGCAACCCACAAACTCTGCCGGTATTTCCAGACCTGGATATCTTCAGCCCGGAATACGCTTGTAACCGCGAAAAATATGCAG CGCGTGCGCTGCGCGATTACCCGCTGCACTTTTATAAACCGCTGAACCTGTGGATTGTCTCCAAACATAAAGACGTTCGTAGCGCGCT GTTCACCCCGCAGGTCTTCAGCTCCGTAGCTTTTGGTCTGCTGCCTCCACCAGACGATATCGCTCCTCGCGTGCCGGACCTGTACACC GACGTTCATCTGCCGTCCATGGATCCGCCGGAGCACACCAAACTGCGTGTTCCGGTGCAGCAGGCTCTGCTGCCGGGCCGTCTGGTAG GCAAAGACGAGGTTGTGCGCCGTATTGCGAACGAACTGATCGATACTTTTATCGACAAAGGCGAATGCGATCTGCTGCATGATTTCTC TTATAAGCTGGCGCTGTACCTGATTGTAGACCTGCTGGGTATCCCTAAAGAACGTGCGGAGGACTACCACCGCTGGTCCAACTGTTTC TTCCAGCTGTTCACGCCGAAGGTTCCTGAACGTGCGGATGCTCGTTTCTTTGTACCGATGCCGGAGGAAGTGCTGCGCCAGAACTGGG AAGGTCTGGCCGAAGCAAATGACTATCTGCGTGAAGTTGTTGAAAACCTGGACCGTAATCCGGGCAACAACATGCTGTCTAACCTGCT GCAACTGCGTGAACCGGATGGCTCTCGTACTATCACTATCTCCGCGAACGTTTGCAACGCCCTGGAATTTGGCGCGGCGGGTCACGAT ACGACCGCAACCCTGATCGCTCACCTGACTTATTTCGTGCTGACCACCCCGGACCTGAAGGACACTCTGACCGAAGATCCATCTCTGA TTCCGGCAGCCATCTCTGAAACCCTGCGTCGTCGTTGCCCGGTTGACGGTCTGTTCCGCCGCACCCTGAGCGACGTAGAACTGTGCGG TCAGAAGATCGAATCCGGTTCTATCGTGTACCTGGACCTGACCGCCGCTAACCTGGATCCGGACGTTTTCCCGGAGCCGGAGACTTTC CGTCTGAACCGCGATAACATTAAAGAAATGGTGTCTTTCGGCTTCGGTCGTCACGTCTGTGCAGGTCAGTACCTGAGCCGCATCGAAG CTAAAGCAGCATACGAAGAACTGATGCGTCGTATTCCTAATATGCGTCTGGCAGATGGCTTCAAACTGGAGTACATGCCGAGCGTGGC CACCACTGTTCTGAAAGGCCTGCCGCTGGTTTGGGATAAAAACACCGGTTAA